One of the most common interests is to find out the RNA expression difference between two states of an organism or a cell. 

What you need: 

- At least 3 biological repeats of RNAseq data from each state of the organism. 

- The adapter sequences used in the RNA sequencing facility to generate the RNAseq data (read 1 and read 2).

- A transcriptome or cDNA data file (in FASTA format) of the organism to match the sequenced RNA sequences to genes.

        Source: Ensembl  

- A gtf - file that supplies meta data to genes. gtf file and transcriptome data file should be from the same source to have matching gene names. A gtf file is identical to a gff file, version 2. 

        Source: Ensembl

3 biological repeats are required to estimate whether the expression difference of a gene between the two states is within the natural variance of expression of this particular gene or not. 

Example Data: 

.gz compressed data files can be used directly and don't need to be decompressed. .zip files should be decompressed.

1. Data trimming exercise: (paired end data)

Read 1 Data: rnaseq test1

Read 2 Data: rnaseq test2

Adapter Sequences: 

Read 1: GTCAACTTCAGTGACAGTGGTCAAACCGGTGGTGACTGGAACTTCAGTAC, 

              CTCGTACTTGCTCCCCAGGTTACAGCTGAACAAAAAAGAATGTGCTTGTA

Read 2: CCGAAATGCAATACTCAAAAGTCGCTATCTTGTCTGCCGTTGCTGGTTCA,
              GCTTAATCTACTACTAATCAATAATATCCGAAATGCAATACTCAAAAGTC

2. Data quantification exercise: 

Source

Organism: Caenorhabditis elegans

States: Starvation - no starvation

Data:  (single end, trimmed)

    No Starvation: n-starv1, n-starv2, n-starv3

    Starvation: starv1, starv2, starv3

Transcriptome database: caenorhabditis_elegans

Genome meta file (gtf-file): caenorhabditis_elegans.gtf